CARTAS AL DIRECTOR: NÚMERO 244/ ENERO / 2021

A quien corresponda: en el artículo Las mascarillas no son eficaces y además son peligrosas para la salud se dice que “según el inmunólogo suizo Alfred Hässig y el médico alemán Heinrich Kremer los linfocitos T no combaten microbios porque su misión es la de reciclar y renovar las células que perdemos cada día”. Hasta donde yo sé los linfocitos T tienen varias funciones: son mediadores en la respuesta inmunitaria y fagocitan, limpian o recambian las células de nuestro organismo. Esto me lo ha confirmado un médico que de esto sabe bastante. Así que lo que dicen el virólogo suizo y el médico alemán o lo malinterpreto o no es cierto; esto es, esa misión sería una de las que tienen. Es más, es sabido que gracias a los linfocitos T muchas personas son inmunes a las enfermedades infeccionas en general y a la Covid-19 en particular. De hecho esas personas darían negativo en un test serológico. Sería la primera barrera contra la infección. Ya me diréis. Gracias

Jorge Arroyo

Sant Cugat del Vallés (Barcelona)

Aunque ya habrá usted recibido la respuesta que ahora transcribimos del autor del reportaje -nuestro compañero Jesús García Blanca- la damos a conocer a nuestros lectores. Y es ésta: «La visión sobre inmunidad que usted nos trasmite -y refrenda el médico al que ha consultado- puede considerarse obsoleta, al menos a nivel de investigación básica. Hace ya varias décadas que nuevas líneas de investigación en Inmunología, Biología y otras ciencias aplicadas a la Medicina descubrieron que lo que llamamos Sistema Inmunitario no funciona como creíamos y su función principal y fundamental es la limpieza y reciclaje diaria del organismo -tarea que realizan los linfocitos T- y no la lucha contra microbios; en todo caso ésa sería una labor puntual que realizan los linfocitos B que hay que reinterpretar superando la visión belicista de la salud y la enfermedad que en su día impusieron Pasteur, Koch y otros. Y decimos impusieron porque no lograron dar un giro de 180 grados a la Medicina mediante un debate científico-médico sino gracias a la intervención de la entonces naciente industria farmacéutica que actualmente es una de las más poderosas del mundo. Los dos nombres citados -el inmunólogo Alfred Hässig y el médico Heinrich Kremer- son solo dos de los muchos investigadores que han aportado sus conocimientos a este nuevo enfoque cuyos pormenores se describen en el libro The Silent Revolution in Cancer and AIDS Medicine del Dr. Kremer y en numerosos artículos científicos del equipo de investigación en inmunología liderado por el Dr. Hassig. El propósito de la breve mención que se hace en el reportaje que usted nos cita era añadir una dimensión más -y quizá más grave- al daño ya documentado que las mascarillas pueden hacer a nivel inmunológico ya que afectaría -desde esta perspectiva- a funciones mucho más relevantes como podrá comprobar leyendo los dos artículos que hemos publicado en nuestra revista sobre este tema y sus novedosos planteamientos con aplicaciones prácticas en la llamada Terapia de Simbiosis Celular (puede encontrarlos en los siguientes enlaces: https://www.dsalud.com/reportaje/tiene-sentido-lo-que-se-dice-del-sistema-inmunitario y https://www.dsalud.com/reportaje/la-terapia-de-simbiosis-celular.

Hola. Soy Ingeniero Informático e Ingeniero en Telecomunicaciones así como Máster Universitario en Bioinformática y Bioestadística por la Universidad de Barcelona. Recientemente he leído -algunos colegas me lo han enviado- un artículo publicado en el nº 242 de vuestra revista titulado La estafa se constata: la PCR no detecta el SARS-CoV-2 en el que he encontrado varios errores o evidencias que no están demostradas. En él se dice que «las secuencias del supuesto SARS-CoV-2 ¡están en los humanos y en numerosos microbios! agregándose «Veamos en detalle el procedimiento tomando como ejemplo los iniciadores del protocolo francés. Una vez en la web de BLAST elegimos Microbes (Microbios) para buscar en las bases de datos de genomas microbianos y avanzamos página. Aparece entonces un formulario en el que introdujimos la secuencia del iniciador forward del protocolo francés -que es ATGAGCTTAGTCCTGTTG-, seleccionamos la opción Highly similar sequences (Secuencias muy similares) y pulsamos la tecla BLAST. Apenas unos segundos después aparecieron los resultados -hicimos una captura de la pantalla (imagen 1)- y se nos mostraron 100 secuencias de microbios -en particular de bacterias y arqueas- con una coincidencia de entre un 77% y un 100% con un porcentaje de identidad del 100%». Para decir que se han encontrado distintos organismos usando un «primer» (cebador que se utiliza para amplificar por el método PCR una secuencia de ADN o ARN, en este caso del SARS-CoV-2) se debe encontrar el «primer» al 100% de identidad (identity) tanto en el primer “forward” como el “reverse” dentro del genoma a un 100% de identidad. No es válido un valor de 77%, ni de 90%, ni del 99%. Tiene que ser del 100%. Después hay que constatar que realmente esos 2 primers (FW/RV) amplifican el SARS-CoV-2. Cabe decir que tanto el primer forward o reverse deben de pertenecer al mismo «primer» que amplifica. Luego dice el artículo: “Como quiera que se trataba de secuencias muy cortas -en torno a una veintena de letras genéticas o nucleótidos- decidimos probar de nuevo pero con la secuencia diana que definen esos dos cebadores, es decir, la secuencia del supuesto genoma del SARS-CoV-2 que se encuentra entre el cebador de inicio y el del final. Obviamente para ello necesitábamos la secuencia que oficialmente se admite como la del “genoma del SARS-CoV-2” y aunque miles de laboratorios aseveran haberlo aislado y secuenciado -una afirmación falsa como hemos explicado en reportajes anteriores- decidimos acudir a la página oficial del National Center for Biotechnology Information (Centro Nacional de Información Biotecnológica): https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903 (https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903). Una vez en ella localizamos la «secuencia diana», fragmento de 108 nucleótidos situados entre las posiciones 12.690 y 12.797 del “genoma” y que es ATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTACACAAACTGCTTGC ACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAG. Pues bien, repetimos con ella las operaciones antes descritas y los resultados volvieron a ser sorprendentes ya que aparecieron de nuevo un centenar de secuencias de microbios con un porcentaje de coincidencia del 100% y cuatro secuencias del genoma humano con un porcentaje de identidad de entre el 83% y el 95%. Las coincidencias eran pues menores pero lo trascendente e importante es que seguimos encontrando fragmentos de la supuesta «secuencia diana» del SARS-CoV-2 tanto en microbios como en nuestro propio genoma”. Pues bien, he comprobado esa secuencia y no devuelve nada de lo que ustedes comentan. Puede ser que devuelva algo pero que esas secuencias estén fuera de rango estadístico. Debería verlas para poder confirmar lo que ustedes dicen. Lo que devuelve esa secuencia son familias del SARS, coronavirus del murciélago y vectores usados para la clonación del virus en laboratorio. No devuelve nada del genoma humano, al menos que pueda ver los resultados y analizarlos, para ver la metodología, ver si es correcta y afirmar lo que ustedes dicen. Con esto no quiero decir que la PCR pueda o no detectar SARS-CoV-2 si no que lo que ustedes han publicado no corresponde a los estándares bioinformáticos ni los resultados pueden ser contrastados ni analizados de una forma bioinformática independiente. Por último, para su información, sí hay secuencias en otros genomas del SARS-CoV-2 pero no utilizando los métodos que ustedes han descrito. Reciban un cordial saludo.

Miguel Romero

Respecto a su primera cuestión: si lee con atención nuestro artículo comprobará que efectivamente se obtuvo un porcentaje de identidad del 100% y que los iniciadores “forward” y “reverse” correspondían al mismo “primer” en cada caso. En cualquier caso, creemos que la descripción que se hace del ejemplo tomado del protocolo francés es lo suficientemente detallada como para que cualquiera, incluso sin formación especializada, pueda repetir el procedimiento que hemos seguido y comprobar los resultados. Respecto a su segunda cuestión: la secuencia diana completa no arrojaba resultados por lo que la dividimos en cuatro fragmentos y buscamos los fragmentos por separado obteniendo los resultados descritos y, en absoluto, nada relacionado con SARS o coronavirus de murciélago. Añadiremos que nuestra pequeña investigación no pretende ser un estudio científico o técnico y mucho menos académico. Consultamos con dos personas que por su titulación y conocimientos sobre el BLAST nos merecían confianza y nos confirmaron la relevancia de los resultados obtenidos sobre los que hemos querido llamar la atención a fin de que investigadores y especialistas en esta herramienta -como afirma ser usted- puedan llevar a cabo comprobaciones más detalladas, precisas y exhaustivas. Le animamos pues a que comparta con nosotros y nuestros lectores su aportación al respecto, empezando por darnos más detalles sobre la afirmación final de su carta. Muchas gracias.

Estas cartas aparecen en
244
Enero 2021
Ver número
Última revista
Último número Octubre 2021 de la revista mensual Discovery DSalud
252 | Octubre 2021
Cartas al director Editorial Ver número